Skip to main content

Table 1 Details on gene amplifications: primers’ name, sequence and references, and PCR conditions used

From: Biogeographic and demographic history of the Mediterranean snakes Malpolon monspessulanus and Hemorrhois hippocrepis across the Strait of Gibraltar

Gene Primer Primer sequence References PCR conditions (°C(time) × number of cycles)
cyt-b CB1 5′ CCATCCAACATCTCAGCATGATGAAA 3′ [28] 94° (3′), [94° (30″), 50° (45″), 72° (2′) × 35], 72° (10′)
CB2 5′ CCCTCAGAATGATATTTGTCCTCA 3′ [28]
MVZ 16 5′ AAATAGGAAGTATCACTCTGGTTT 3′ [29]
12S 12Sa 5′ CTGGGATTAGATACCCCACTAT 3′ [30] 94° (3′), [94° (30″), 49° (30″), 72° (1′) × 35], 72° (5′)
12Sb 5′ GAGGGTGACGGGGCGGTGTGT 3′ [30]
MC1R MC1R F 5′ GGCNGCCATYGTCAAGAACCGGAACC 3′ [31] 94° (3′), [94° (30″), 50° (30″), 72° (1′) × 35], 72° (5′)
MC1R R 5′ CTCCGRAAGGCRTAGATGATGGGGTCCAC 3′
BDNF BDNF_DRV_F 5′ ACCATCCTTTTCCTKACTATGG 3′ [32] 94° (3′), [94º(30″), 50° (45″), 72° (2′) × 35], 72° (10′)
BDNF_DRV_R 5′ CTATCTTCCCCTTTTAATGGTC 3′