Skip to main content

Table 2 Seven EST-SSR primer pairs suitable for analyzing the DNA polymorphism in Bgt

From: Virulence structure and its genetic diversity analyses of Blumeria graminis f. sp. tritici isolates in China

codes Primers Sequences repeat motif Annealing temperature (°C)
1-F Blu SSR3–1 TTCGAGGCAAGCTCTTCTCA (CCGTTC)4 56
1-R Blu SSR3–2 TTTCGGCAGGCAAGTTTATT
2-F
2-R
Blu SSR18–1 GGGTAACGATTGGTTAGGTGCT (ATCACC)3 56
Blu SSR18–2 AGGTGGTGGTAAAGGGGATGAT
3-F
3-R
Blu SSR29–1 GGAGGATCGGTAGCAGTG (GCA)5 56
Blu SSR29–2 GCGGCGGTAGCTTCTTTT
4-F Blu SSR32–1 GGGGAGGTATAGGTGAGG (TCT)6 52
4-R Blu SSR32–2 GAGCGTTTGCTGTTCTGT
5-F Blu SSR35–1 AGACTCACAGCAGAGCAAA (CTTCAA)3 52
5-R Blu SSR35–2 GCAGATCCATGATCTTCGT
6-F Blu SSR41–1 ATCCATTGTAGTTAGGAGCCA (AC)6 54
6-R Blu SSR41–2 ATGACCTGATTGATTTATCCC
7-F Blu SSR44–1 TGAGGATTTAGATGATATGGA (AGA)5 52
7-R Blu SSR44–2 GATCTTAAATTATTTTGACCG