Skip to main content

Table 2 Primers used for gene amplification and sequencing

From: Nature of selection varies on different domains of IFI16-like PYHIN genes in ruminants

Gene Primer name Sequence (5′ – 3′) Tm (°C) Length (bp)
IFI16-L IFI16FW (Full ORF) AGCCAGCACTAAATCAAGGGTTTTGACTAGTC 62 32
IFI16RV (Full ORF) GCCAAGTTATAAAAGTTATAGATGCAAAATGGGACA 60 36
IFI16FW2 GTGACACAGCCACCAAACCTAAGGAC 61 26
IFI16FW3 GAGGCACATCCCTAATTTGAGAGATGGGG 63 29
IFI16RV1 ATCTGGCCACTGCTCACAGTTGGG 61 24
M13 M13/pUC GTAAAACGACGGCCAGT 47 17
M13/pUCRV CAGGAAACAGCTATGAC 45 17