Skip to main content

Table 1 List of primers used for gene expression analysis by quantitative real-time PCR (qPCR)

From: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish

Gene name Primer sequence (5’→3’) Amplicon (bp) Ta (°C) Efficiency R2
ogn1 F: GAAGTCTCTCTTATTCACCTGT 138 60 92.4 0.99
R: CAAAGGGTCACTGAAGTATCCA
ogn2 F: TGTTATTCTCCCATGGATCCTG 125 60 100 0.99
R: GATCCCCCGCTGCATCTGTGG
ogn1 F: GAAGTCTCTCTTATTCACCTGT 544 60 na na
R: GTTGTTGGCATTGAAGGAT
ogn2 F: ATGATGCAACTGAGGACTTTAA 392 60 na na
R: GCTCCATCTTCAATCTCAG
op F: AAAACCCAGGAGATAAACTCAAGACAACCCA 153 68 95.3 0.99
R: AGAACCGTGGCAAAGAGCAGAACGAA
  1. Gene name, primer sequence, amplicon length (base pairs, bp), annealing temperature (Ta, ºC) and efficiency (%) and R2 are indicated for each primer pair. For ef1α, rps18 and ß-actin, the sequences and specific conditions have previously been reported [61]. F forward, R reverse, na not applicable. The longer ogn amplicons were used to generate the standards for qPCR