Skip to main content

Table 2 Primers used for SDBE and Os125 gene amplifying and sequencing

From: Polyploid evolution in Oryza officinalis complex of the genus Oryza

Gene name Primer Sequence(5'-3')
Starch Debranching Enzyme SDBE-F ATTGTCTGCTGCTGGCTTGA
  SDBE-R CTATTGCCGCTTGTTGCTC
  SDBE-Fs2 AAAGGGCAAGCCAACGCAAAT
  SDBE-Fs3 TGGACAGCCGACAGACTTGC
Os02 g0125000 Os125-F CCAGAAGAATGGGACAGC
  Os125-R GACAGGGAGTTCCAGAGC