Skip to main content

Table 2 Primers used for cloning and sequencing

From: Independent inactivation of arginine decarboxylase genes by nonsense and missense mutations led to pseudogene formation in Chlamydia trachomatisserovar L2 and D strains

Primer name Sequence1
CTL06263'F GCTCCAGACTTCCAACTC
CTL06295'R TGTAAAGCCATGAAGAAGG
5CT373X CGGCTCGAG ATGCCTTACGGAACTCG
3CT374H GCAAGCTTACAAATGGATTTTATTAGC
5CT373N GGTCAT ATGCCTTACGGAACTCG
3CT373B GCTGGATCCTTATTGGATAACAGCAGGC
5CT373X128W CAGAATACGTAGAGTTTTTCCCAACTTGGATCGATGATGAAATCGCAGAAT
3CT373X128W ATTCTGCGATTTCATCATCGATCCAAGTTGGGAAAAACTCTACGTATTCTG
5CT372X GGGCTCGAG ATGTCCTTCCGTTCGGTTTTAC
3CT374R CGCGAATTCTTACAAATGGATTTTATTAGC
5CT373R115G GGAGAGCTCATCGGGGGCTGGGCAG
3CT373R115G CTGCCCAGCCCCCGATGAGCTCTCC
pBAD-Fwd2 CGTCACACTTTGCTATGC
pBAD-Rev GATTTAATCTGTATCAGGCTG
CTseq1 GATCAGCTACATGATCGGAG
CTseq2 TCAGTACTCACTCTATGCAATAG
CTseq3 CCGTGTTTATAGCGTGCGAGC
CTseq4 GTGATCAGCTCCATGATCG
T7-Promoter GTAATACGACTCACTATAGGG
T7-Term GCTAGTTATTGCTCAGCGG
  1. 1 Restriction sites are underlined and the initiator codon is shown in italics.