Skip to main content

Table 2 Mitochondrial DNA sequence polymorphisms detected in Scots pine1.

From: Glacial vicariance in Eurasia: mitochondrial DNA evidence from Scots pine for a complex heritage involving genetically distinct refugia at mid-northern latitudes and in Asia Minor

Mitotype nad7 intron 1 (positions 621–681) nad1 intron B/C (positions 101–137)
AA GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAAAGGGCCTG GGA-------------------------------GAG
BA GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAA-----CTG GGA-------------------------------GAG
CA GGG--------------------------------GGCAAATAAGTAAAAAAAAGGGCCTG GGA-------------------------------GAG
AB GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAAAGGGCCTG GGACCCTTTAGGGGGCTCGACCATAGGGAGAGGAGAG
  1. 1Polymorphisms detected in the intron 1 of the mitochondrial gene nad7 and in the intron B/C of the mitochondrial gene nad1 in Scots pine, and nomenclature used for multi-locus haplotypes (mitotypes).