Skip to main content

Table 1 Primer sets used for the amplification and sequencing of nuclear (nDNA) and mitochondrial (mtDNA) DNA

From: Molecular phylogeny of microhylid frogs (Anura: Microhylidae) with emphasis on relationships among New World genera

Locus (Primer) Type Direction Sequence (5’ to 3’) Reference
16S (16SAR) mtDNA F CGCCTGTTTATCAAAAAC AT [21]
16S (16SBR) mtDNA R CCGGTCTGAACTCAGATCACGT [21]
28S (28SV) nDNA F AAGGTAGCCAAATGCCTC ATC [22]
28S (28SJJ) nDNA R AGTAGGGTAAAACTAACC T [22]
BDNF (BDNF.Amp.F1) nDNA F ACCATCCTTTTCCTTACTATG G [16]
BDNF (BDNF.Amp.R1) nDNA R CTATCTTCCCCTTTTAATGGTC [16]
Tyrosinase (TyrC) nDNA F GGCAGAGGAWCRTGCCAAGATGT [23]
Tyrosinase (TyrG) nDNA R TGCTGGCRTCTCTCCARTCCC A [23]