Skip to main content

Table 3 Primer sequences used for RT-qPCR

From: Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio)

Gene symbol Entrez Gene ID Forward primer 5' -› 3' Reverse primer 5' -› 3' ATa
mRNA quantification
fabp1a 791610 TAAGCTGACAGCGTTTGTGAAGGG AGATGCGTCTGCTGATCCTCTTGT 60.0
fabp1b.1 554095 AAGCTGAAGGTGGTGCTGAACA CACGTTTGCTGATGCGCTTGTA 59.0
fabp1b.2 EB880179 TGCCGTTCTCTGGGAAGTTTGAGT TGACTTTGTCTCCGCTCAGCATCT 61.0
fabp7a 58128 TGTGCCACTTGGAAACTGGTTGAC AACATTGCCTACTTGCCTGGTAGG 60.0
fabp7b 407736 AAACCACTGCTGATGACCGACACT AGTGGTCTCTTTCCCATCCCACTT 61.0
fabp10a 171481 TTACGCTCAGGAGAACTACG CTTCCTGATCATGGTGGTTC 55.0
fabp10b 795210 CGGCTCCAGAGCACTACATC GTTCACTCATGTGCGGGAGC 60.0
fabp11a 447944 TGTGCAGAAACAGACCTGGGA ACAGCCACCACATCACCCATCTT 60.0
fabp11b 553579 GCTGTCACTACATTCAAGACCTG AGTTTACCATCCGCAAGGCTCA 60.0
acox1 449662 AGTCAGCACGAGCTCTCTCC GCCCTACAAAGTGAAAGGCA 58.0
rpl13α 560828 AGCAAGTGCTGTTGGGCCAC GTGTGGCGGTGATGGCCTGG 61.0
hnRNA quantification
fabp1a 791610 ATCAATGGAGGTCAACGGCGAC CAGCATGCGTGAAGCCGCCC 62.5
fabp1b.1 554095 GAACTAACGTGTGCTGCTTGTG CACGTTTGCTGATGCGCTTGTA 57.0
fabp7a 58128 CCATCCATCAGATTTCTATGTGGG CATTATGCCTTCTCGTATGTGCG 56.5
fabp7b 407736 TTGGAAATGTGACCAAACCGACGC TCGTCTCGAAAGGGAATGCAGTGT 61.5
fabp10a 171481 TCCAGCAGAACGGCAGCGAC CGCCTGTAAAGTGAAGCCATTTCCA 61.0
fabp11a 447944 CCAAGCCGTTTTTGATGATGTGAG GCTATTAATTTCCCATCCGACACC 57.0
acox1 449662 GGCTACTCCCGCTGCAGCAG GGCCTGAGGGTTGTTGGGCC 63.0
rpl13α 560828 ACCAACCCTTCCCGTGGACCA AGCCAATGCTTGCTTCTACAACAGA 61.5
  1. aAT, annealing temperature (°C).