Skip to main content

Table 1 Primers used for 3' and 5'RACE.

From: Molecular evolution of the crustacean hyperglycemic hormone family in ecdysozoans

Primer Species Sequence (5' to 3') Tm (°C)
DamITP-Up1 Daphnia magna TCCAGCGGCCATCATTCGTTGTCC 71
DamITP-Up2 Daphnia magna CCTCGACCGCATTTGCCAAGACTG 71
DamITP-Down1 Daphnia magna GGACAACGAATGATGGCCGCTGGA 71
DamITP-Down2 Daphnia magna ACTGGGAAGCACTGCGAGCAAAACC 72
FocITP-Up1 Folsomia candida GCCAAGCTGGACAGAATTTGCGACGAT 73
FocITP-Up2 Folsomia candida ACAACTCCACTCGCTATGCAGGTCGAA 73
FocITP-Down1 Folsomia candida TTCGACCTGCATAGCGAGTGGAGTTGT 73
FocITP-Down2 Folsomia candida ATCGTCGCAAATTCTGTCCAGCTTGGC 73
\