Skip to main content

Table 3 The primers used to amplify the four overlapping long range amplicons.

From: Evolutionary relationships and divergence times among the native rats of Australia

A.   
Primer name Sequence (5' to 3')
Av175312SF AAACTGGGATTAGATACCCCACTAT
R6036R ACTTCTGGGTGTCCAAAGAATCA
BatL5310 CCTACTCRGCCATTTTACCTATG
LR2RB CTGATTGGAAGTCAGTTGTATTTTT
L10647F TTTGAAGCAGCAGCCTGATAYTG
RCb9H TACACCTAGGAGGTCTTTAATTG
RGlu2L CAGCATTTAACTGTGACTAATGAC
Long 16SR TGATTATGCTACCTTTGCACGGTCAGGATACC
B.   
Region amplified Primer pairs Amplicon length
12S - COI Av175312sf & R6036R 5.55 kb
COI - COIII BatL5310 & LR2RB 4.11 kb
COIII - Cyt b L10647F & RCb9H 5.53 kb
Cyt b - 16S RGlu2L & Long 16SR 4.26 kb
  1. (A) The primer sequences (5' to 3'). (B) The primer pairs used for each genome region and the amplicon length.