Skip to main content

Table 2 Primers for real-time qPCR, amplification efficiency (%) and amplicon size (bp).

From: Genomic organization and gene expression of the multiple globins in Atlantic cod: conservation of globin-flanking genes in chordates infers the origin of the vertebrate globin clusters

Gene Name Sequence (5' to 3') Efficiency Size
α1 A1F GACTTACTTCAGCCACTGGAAGAGCCT C 96 153
  A1R TTGAAGGCGTGCAGCTCGCTCAGAG   
α2 A2F GTCCTATTTCTCTCACTGGAAGGACGCG 85 153
  A2R ATGAACGCGTGCAGCTCGCTAAGGC   
α3 A3F CACATCATACCCTGGCACCAAGAC 95 172
  A3R CTGGTAGGCGTGGTAGGTTTGAAGAG   
α4 A4F TTCTCCCACTGGAAAGACCTCGG 70 138
  A4R ATGGAGCTCACTGAGCTCGAGAAG   
β1 allele A B1FA TTATGGGAAACCCCAAGGTGGCCAA 91 131
  B1R GTGCAGTTTCTCGGAGTGCAGCACGC   
β1 allele B B1FB TTGTGGGAAACCCCAAGGTGGCTGC 98 131
  B1R GTGCAGTTTCTCGGAGTGCAGCACGC   
β2 B2F CCTGTACAATGCAGAGACCATCATGGC 84 151
  B2R GTGCAGCTTGTCAGAGTGGAGCAGAG   
β3 B3F ACAGATAGTGAGCGCGCCATCATTAA 86 176
  B34R GCGGCGATCAGGGGGTTGCACAG   
β4 B4F ACAGATAGTGAGCGCGCCATCATTAC 95 176
  B34R GCGGCGATCAGGGGGTTGCACAG   
β5 B5F GTGGACTCGGAGGTACTTTGGAAAC 89 168
  B5R TGCAGCTGACTGAGCTCGCAATAG   
Ubiquitin UbiF GGCCGCAAAGATGCAGAT 81 69
  UbiR CTGGGCTCGACCTCAAGAGT