Skip to main content

Table 2 Primers and PCR cycling conditions used in this study.

From: Revisiting the taxonomy of the Rattini tribe: a phylogeny-based delimitation of species boundaries

Designation Gene Name Nucleotide sequence 5' → 3' Annealing Temperature Fragment Length (bp) Original Publication
Cytb cytochrome b     
L14723   ACCAATGACATGAAAAATCATCGTT 50°C 1213 [69]
H15915   TCTCCATTTCTGGTTTACAAGAC    
COI Cytochrome c oxydase I     
BatL5310   CCTACTCRGCCATTTTACCTATG 48°C 750 [25]
R6036R   ACTTCTGGGTGTCCAAAGAATCA    
IRBP1 Interphotoreceptor retinoid binding protein (fragment 1)    
I1-Rattus   ATTGAGCAGGCTATGAAGAG 58°C 785 this study
J2-Rattus   TAGGGCTTGCTCYGCAGG    
IRBP2 Interphotoreceptor retinoid binding protein (fragment 2)    
I2   ATCCCCTATGTCATCTCCTACYTG 52°C 892 [70]
J1   CGCAGGTCCATGATGAGGTGCTCCGTGTCCTG    
cytb barcode Cytochrome b (museum specimens)    
MPLeopol-fw MPRattusSL-Rev   GAYAAAATYCCATTCCACCC TARTTRTCYGGGTCTCC 48°C 122 this study
  1. The IRBP gene was amplified into two overlapping fragments, IRBP1 and IRBP2.