Biomonitoring via DNA metabarcoding and light microscopy of bee pollen in rainforest transformation landscapes of Sumatra

Table 1 Barcoding regions, PCR primer sequences, and amplicon sizes

Barcode regions	Primer	Sequence	Size	References
rbcL	rbcL 2_f	TGGCAGCATTYCGAGTAACTC	500 bp	Palmieri et al. [68]
rbcL	rbcLa-R_r	GTAAAATCAAGTCCACCRCG	500 bp	Kress and Erickson [69]
ITS2	ITS2 S2F_f	ATGCGATACTTGGTGTGAAT	350–400 bp	Chen et al. [70]
ITS2	ITS2 S3R_r	GACGCTTCTCCAGACTACAAT	350–400 bp	Chen et al. [70]

ISSN: 2730-7182