Skip to main content

Table 7 Markers used in the microsatellite analysis

From: The emergence of ecotypes in a parasitoid wasp: a case of incipient sympatric speciation in Hymenoptera?

Marker Chromosome Position (cM) No. alleles Sequence (5ʹ → 3ʹ)
Nv109 5 42.7 20 GCTTACTCTCGGGAACTGGA
CGAGCATTAACCATCAGCAG
Nv114 4 48.6 19 ATGGGCAATAAAACGAAACG
CATCCTTGCGGAGACACTAA
Nv209 2 39.8 13 CCAACTTCTTATTCGTAAGGGAA
ACCATTCGCTGGCTGGTA
Nv217 3 97.4 23 AATGGCATTATGCGAATGA
CTGCTCTCTGCATGAATCTTT
Nv306 2 48.1 6 TGCTCGGATTTCGAACATTT
GCGGATGTTGTTCCGTTATT
Nv311 1 50.3 17 ACTGGCGAAAGCTCAAACC
TCGAGCTTTGTTCTGGGATA
Nv319 3 12.6 24 TTTGAGGTTATGCGTCGTTTC
GAGCGGAGTGCTTCATTCAG
Nv321 4 89.3 9 CGGTGAGACTCGTGAGATGA
AACCGCAGCTCTCAACATTT
   Average 16.37