Skip to main content

Table 2 Primer pairs used to amplify the ancient mtDNA control-region sequence

From: Ancient mitochondrial DNA connects house mice in the British Isles to trade across Europe over three millennia

Fragment name Primer name Primer sequences (5′-3′) Size (bp) Reference
Fragment 1 Mm-1F GCACCCAAAGCTGGTATTCT 146 [25]
  Mm-1R TTTTATGACCTGAACCATTGATT   Modified from [25]
Fragment 2 Mm-2F CCAAGCATATAAGCAAGTACAT 141 [25]
  Mm-2R GTATGTCAGATAACACAGATAT   Modified from [25]
Fragment 2a Mm-2aF CAATATATATACCATGAATATTATCTTAA 121 This study
  Mm-2aR AAGGGGATAGTCATATGG   This study
Fragment 2b Mm-2bF ATCTGTGTTATCTGACATACACC 150 This study
  Mm-2bR TTTAATGGGCCCGGAGCGAGAA   This study
Fragment 2c Mm-2cF ACTATCCCCTTCCCCATTTGG 143 This study
  Mm-2cR GTAAGAACCAGATGTCTGATAA   This study
Fragment 3 Mm-3F TCTACCATCCTCCGTGAAA 145 Modified from [25]
  Mm-3R TATGGGCGATAACGCATTTGAT   [25]
Fragment 4 Mm-4F CTTTATCAGACATCTGGTTCTT 124 [25]
  Mm-4R CACAGTTATGTTGGTCATGG   This study
Fragment 4b Mm-4bF CTTAAATAAGACATCTCGATGG 142 This study
  Mm-4bR TAGACTGTGTGCTGTCCTT   This study
Fragment 5 Mm-5F CTTTCATCAACATAGCCGTCAA 129 [25]
  Mm-5R CATTTATGTCTAACAAGCATGAA   This study
Fragment 6 Mm-6F CACCTACGGTGAAGAATCATT 146 [25]
  Mm-6R TGTTTTTGGGGTTTGGCATTAA   [25]
Fragment 7 Mm-7F CTCAATACCAAATTTTAACTCTC 144 [25]
  Mm-7R GTCATATTTTGGGAACTACTAG   [25]
Fragment 8 Mm-8F CTATCAAACCCTATGTCCTGA 140 [25]
  Mm-8R CTTGTTAATGTTTATTGCGTAA   Modified from [25]