Skip to main content

Table 1 The marker set for Megachile sculpturalis including primer sequence (F = forward and R = reverse), repetition motif, four primer mixes (PM1—4), amplification length (ASR), polymorphic information content (PIC) and unbiased expected Heterozygosity (uHeL) per locus

From: Evidence for multiple introductions of an invasive wild bee species currently under rapid range expansion in Europe

Locus Primer sequence (5′–3′) Repetition motif Primer mix ASR PIC Number of alleles uHeL
FB1 F: TTTTTCGTCGTCACGCTG CCTTT-9 PM 1 412–422 0.487 3 0.564
  R: CGGAGTTAAAGGAAGGGAAA       
FB2 F: ACCGACGCTATTAAAATTGTC AGAAG-19 PM 3 407–437 0.558 3 0.638
  R: TCCACGAAAGAGTTCTTTGT       
FB3 F: GTGAAATCGACGCGAAAC TTTCG-10 PM 4 421–441 0.501 3 0.592
  R: ATTGGTCTTCTGGTTCGTTT       
FB4 F: GTAGACACCTCGTGACTTTT GAGAG-9 PM 3 412–422 0.278 3 0.312
  R: ATAAGCCGCGACACAAATT       
FB5 F: CTGTCGAGTCGGACCTTT TCTTT-12 PM 1 442–447 0.322 2 0.406
  R: ATCGACGAGTTTTTGTACGA       
FB6 F: ACGTTCTTCTTACGATTCTTC ATAGA-8 PM 3 463–478 0.704 5 0.754
  R: GGAATGCCTTTTCGAGTTTC       
FB7 F: AAGAGAACAATAAGTCGAACG TCTTT-7 PM 4 360–400 0.566 4 0.643
  R: TGAACGTACGTAATTTGCAT       
FB8 F: TCGTACGAGAAACGAAAGG TTTCG-10 PM 3 390–410 0.492 3 0.585
  R: AGTCAGACGAGTAGTTAGGC       
FB9 F: ACCCCACGAATGTTAACG CGACG-8 PM 1 398–433 0.519 5 0.573
  R: TTTACGGCCGAGTTTTCC       
FB10* F: CGTCAAAGGCTACCGTATAA AACAG-14 PM 3 436–441 0.2 2 0.227
  R: CCTTCAATGTTCAAGGTGAA       
FB11 F: CCACTTTATCCGTTTGTTCG AATCG-9 PM 3 415–430 0.603 4 0.658
  R: ACGGCGAAATCGAGTCTTA       
FB13 F: TTGAATCTCTGCTCTGTGAC TTTTC-11 PM 3 442–467 0.576 3 0.656
  R: GCGGTGATATTAGACTCGTA       
FB14 F: GTCGAGCGATTGGAGTAATC TACTC-8 PM 1 420–495 0.509 4 0.554
  R: CGTACCTCGAAAATACGCT       
FB15 F: GAACAGAAGGTTTGTTCGC TCGTA-9 PM 4 440–485 0.43 5 0.477
  R: TTCCATCTGGCACGATAG       
FB16 F: CTGAAGTCATTCGGGTAAGA CGAAA-9 PM 3 412–427 0.478 4 0.538
  R: TCGTACTTTTCACCCTGAAA       
FB17 F: CGGGCATGAACGAATATTCT TTCGT-7 PM 1 420–455 0.491 4 0.543
  R: TACTTTTAACGTCGCGTATT       
FB18* F: GAACGTTGACCAAGTGGATT AAAGA-8 PM 3 400–400 0.229 2 0.266
  R: AGTTCGAGCTGTCACTTTTT       
FB19 F: CTAATTGCCATCGAGCCAG CGTTC-8 PM 3 445–470 0.501 5 0.557
  R: GACGATCTTGGTTAAAACAGT       
FB20* F: CTTCTCGTTCGAGGATCATT CTTC-8 PM 1 435–435 0 1 0
  R: GGTCAAGGTAAAGGAAGGAG       
FB21 F: AAGCATCGTACCTCGGTATA ACGA-5_GAAC-11 PM 1 378–410 0.678 5 0.73
  R: GTGTTCCCTTTAAAACTCGC       
FB22 F: CTCTGTCTCAGGTTAGTGTG TCTT-13 PM 3 412–424 0.294 5 0.311
  R: AATAGAGCGCATTACCGATT       
FB23 F: GATATCGATCCCATCCGAAA GTGC-12 PM 3 384–400 0.735 7 0.774
  R: TCTCACGATGATTATACGTCC       
FB24 F: CAAACTTTCCTGGTACCGG TTTC-11 PM 4 390–402 0.538 3 0.618
  R: ACGATTAAATCATTTCGGTTGA       
FB25 F: TTGAAATTCAACGTATGCGC AGAA-11 PM 1 434–434 0.556 5 0.635
  R: GAACGGCGAAACTTCTATTC       
FB26 F: AATCGAAAAAGAAACACGGG GAAG-7 PM 3 429–433 0.581 3 0.661
  R: AGAAACTCACCTTGTCCATC       
FB27 F: ATTGTTGAGGCGAATAACCT ATGT-10 PM 4 403–443 0.677 5 0.728
  R: TCGTTAAGAATGAATGAACGA       
FB28 F: CCTTGGTCTCGTCGTTATTA TCTT-8 PM 3 416–422 0.699 5 0.749
  R: GTCGTTTAACCGAGACGC       
FB29 F: TACCTTTCGTCAAAGATGCA TATT-8 PM 3 432–444 0.425 4 0.536
  R: ATAGAAGCATGTCAACACCC       
FB30 F: CGGGTACGACAAGGATTAAA CCAA-9 PM 4 427–435 0.592 3 0.671
  R: ATCAGCCTAGAGTGTAGAGG       
FB31 F: GATCACCTACGTAATGCTGT GAAC-7 PM 1 421–421 0.535 4 0.611
  R: CGCCACTCGCATAAAATTAA       
FB32 F: TCCCGGGCAAAGATAAATAT GTTC-11_TTCG-5 PM 3 409–441 0.676 5 0.728
  R: ATATATCGCCTCGTGTTACG       
FB33 F: GAAGAGCCTATAGACCCTGT CCTT-10 PM 3 400–420 0.621 5 0.692
  R: AACTATTGCCGAGTTATCCG       
FB34* F: TTTCATAATTTACGCGTCTCTC ATCT-8 PM 1 400–400 0 1 0
  R: ATATCGAATCTACCTCTGTGC       
FB35 F: TTAAACTCCATTACGCGTCA ATAG-12 PM 3 445–453 0.407 3 0.493
  R: CATCGCGGACAATAAACTTT       
FB36 F: AACTGATCCCCTGCCATT GCGT-9 PM 4 399–415 0.66 4 0.717
  R: TGTTCTAGCGCATCTGATTC       
FB37 F: AGCAAAAACGTGAAGAATGA GCGT-12 PM 3 373–401 0.58 3 0.659
  R: AAATTTTCGACCACATACGC       
FB38 F: ACCTTAGTCGTTAGTAGCCT TCTG-7 PM 3 417–421 0.537 3 0.621
  R: CGGAAGGAAATTTCGTACGA       
FB39 F: GCTGACTTGCACACAAATTT AAGG-10_AAAG-5 PM 3 406–426 0.66 5 0.715
  R: CGATCCCGTTATCTTCGATT       
FB40 F: GCAAGAAACAAAAACCGTTG CTCA-18 PM 1 385–421 0.522 4 0.6
  R: CGTTAGTCTGACAGTTTTCG       
FB41 F: TTTGCTACAAAACACTGGAC AGAA-7 PM 3 430–450 0.716 5 0.763
  R: GTACCTCTCGAACTTCCTTT       
FB42 F: TTGTGTCACCTTTAATCGGT TTGC-8 PM 4 444–508 0.563 6 0.604
  R: GGATAAAAATCCGTGCGAAA       
FB43 F: TGTTCGCCTCTAGATCGATA TCCT-11 PM 3 419–443 0.624 5 0.69
  R: GCGTTAATCAAATGGTTCGA       
FB44 F: ACGCGAATAATTTACGATGAC CGTT-10 PM 3 399–407 0.522 4 0.572
  R: GATTAAACAAAAGCGGCAAC       
FB45 F: GAATCGCCAAAAGTGCATAA GAAG-14 PM 1 438–454 0.376 3 0.491
  R: TACTTTCGAGTCTACTTGCC       
FB46 F: CCGGGGGAAAGTTCAATTTA GAAA-9_AGAA-11 PM 4 435–507 0.525 6 0.593
  R: TTGTAATTTGCAATCGCGAT       
FB48 F: GAAAAGGAAAGTCGAAACGG CGTT-9 PM 4 373–405 0.557 4 0.634
  R: TACCAGATAGAAACGCGATG