Table 2 List of putative miR394s predicted from newly sequenced genome. The MIR394 sequences from newly sequenced genome were identified through our customized workflow (Fig. 2) and predicted using miRNAFold tool citing their co-ordinates. The putative miR394s of respective MIR394 were validated using RNAfold webserver, which calculates minimum free energy (MFE) of the canonical secondary structure of predicted miRNAs. The nomenclature of the predicted miRNAs was in accordance with miRBase nomenclature system
Name of plant species | Gene Id | miR394 IDs | Predicted Precursor from MIR394 | Predicted minimum free energy (kcal/mol) | Putative miR394 Sequence | |
|---|---|---|---|---|---|---|
Start Position | End Position | |||||
Arachis duranensis | LOC107481607 | adu-miR394 | 314 | 467 | −63.37 | UUGGCAUUCUGUCCACCUCC |
Arachis ipaensis | LOC107634751 | aip-miR394 | 340 | 495 | −71.4 | UUGGCAUUCUGUCCACCUCC |
Camelina sativa | LOC104740735 | csa-miR394a | 509 | 666 | − 77.2 | UUGGCAUUCUGUCCACCUCC |
Camelina sativa | LOC104756391 | csa-miR394b | 408 | 555 | −70.7 | UUGGCAUUCUGUCCACCUCC |
Camelina sativa | LOC104702369 | csa-miR394c | 544 | 692 | −58.2 | UUGGCAUUCUGUCCACCUCC |
Cucumis sativus | LOC105435326 | cst-miR394a | 285 | 429 | −51.9 | UUGGCAUUCUGUCCACCUCC |
Cucumis sativus | LOC105434629 | cst-miR394b | 196 | 350 | −53.9 | UUGGCAUUCUGUCCACCUCC |
Erythranthe guttatus | LOC105950700 | egu-miR394 | 248 | 407 | −53.3 | UUGGCAUUCUGUCCACCUCC |
Eucalyptus grandis | LOC104450295 | era-miR394 | 213 | 370 | −52 | UUGGCAUUCUGUCCACCUCC |
Fragaria vesca | LOC105349875 | fve-miR394 | 538 | 675 | −57.5 | UUGGCAUUCUGUCCACCUCC |
Ipomoea nil | LOC109181078 | ini-miR394 | 524 | 681 | −67.1 | UUGGCAUUCUGUCCACCUCC |
Juglans regia | LOC108984513 | jre-miR394 | 507 | 663 | −64.8 | UUGGCAUUCUGUCCACCUCC |
Musa acuminata | LOC108951711 | mac-miR394 | 155 | 327 | −73.6 | UUGGCAUUCUGUCCACCUCC |
Nelumbo nucifera | LOC109115150 | nnu-miR394 | 562 | 718 | −46.1 | UUGGCAUUCUGUCCACCUCC |
Nicotiana tomentosiformis | LOC104110977 | nto-miR394 | 188 | 326 | −49.3 | UUGGCAUUCUGUCCACCUCC |
Populus euphratica | LOC105109932 | peu-miR394a | 1175 | 1323 | −70.7 | UUGGCAUUCUGUCCACCUCC |
Raphanus sativus | LOC108816492 | rsa-miR394a | 108 | 261 | −58.5 | UUGGCAUUCUGUCCACCUCC |
Raphanus sativus | LOC108816348 | rsa-miR394b | 117 | 270 | −57.4 | UUGGCAUUCUGUCCACCUCC |
Raphanus sativus | LOC108816010 | rsa-miR394c | 1742 | 1842 | −40 | UUGGCAGUAUGCCCACCUCC |
Populus euphratica | LOC105137284 | peu-miR394b | 1196 | 1344 | −65 | UUGGCAUUCUGUCCACCUCC |