Skip to main content

Table 3 Amplification and sequencing primers used for verification of linearity mtDNA genome

From: The linear mitochondrial genome of the quarantine chytrid Synchytrium endobioticum; insights into the evolution and recent history of an obligate biotrophic plant pathogen

Primer name Primer sequence (5′ - 3′ direction)
M13F_polyG TGTAAAACGACGGCCAGTGGGGGGGGGGGGGGGG
M13F TGTAAAACGACGGCCAGT
mtDNA_0007-fw GTTTTCTTAGGCCCATCCT
mtDNA_00787-rv CAGTTTTCTCTAGGGTTCCA
mtDNA_03691-rv AATAGACTATCAGAACCACCAAG
mtDNA_69209-fw CTCAAACACAGAAATTAACAACG