Skip to main content

Table 4 PCR primers used in quantitative RT-PCR study

From: The evolution of a series of behavioral traits is associated with autism-risk genes in cavefish

Primer Name Ensemble Gene ID Forward Sequence Reverse Sequence
shank3b ENSAMXG00000009680 AGTATGACCCACGGCTAGAG CGATCACATAATCACTGTAGGAGG
shank3a ENSAMXG00000004290 CGAATTACACCAGCAGAAATCAG CCTCAGTAGCTCCGAAAGAC
adnp2a ENSAMXG00000006355 AGAGTCACTGGATGTGATTCAC TTCTTGGTTCAAGTCGATGATCTC
suv420h1 ENSAMXG00000020652 AAATGAACACCAGGTTTCGAC AGAAAGTGATGTCTGCTCCA
kmt5b ENSAMXG00000017258 GGCTGATGATTGAAACAGAGAC CATGTCGTCTTCCATTTACTACC
pogza ENSAMXG00000020522 TATTACACGCGTATTTCAGGG TAGACACAGATATCCACGAAGAG
ptena ENSAMXG00000010994 CGGGACTACTTGATTCTAACTCTG TACAACTTCACCTTAAAGTTCGGG
scn2a ENSAMXG00000004964 TCTTCACCTACATCTTCATCCTG CCAAAGACACATCTACAATGAGG
b2m ENSAMXG00000011344 TTCACACCTCAGAAGAACGA ACTGCATTCTCCATCTGGT
eef2a.2 ENSAMXG00000018020 TATCATTGAGGAGTCTGGAGAG TGGGTCGGATTTCTTAATTGG
rps18 ENSAMXG00000007922 CCATCAAGGGTGTTGGTAGG TGCATAATGGTCACCACCC