Skip to main content

Table 1 Table shows motifs 1 and 2, their location in the mitogenome and the specific motif sequence

From: Monoplacophoran mitochondrial genomes: convergent gene arrangements and little phylogenetic signal

Motif no. Occurrence NCR border Starting position within NCR Motif sequence
1 L. antarctica trnG/trnE 55 TATATATATATAGATATATG
1 Vema ewingi trnG/trnE 78 TATATATATATATACATATG
1 L. antarctica trnF/trnT 893 TATATATATATAGACTATCG
1 Vema ewingi trnF/trnT 898 TATACATATATATACTTAGC
2 L. antarctica nad2/trnC 23 CCTCGAAATCGTTGCATC
2 Vema ewingi nad2/trnS1 22 CCTCGAAATCGTTGCATC