Skip to main content

Table 3 A list of primers used in the analysis. See text for primer sources

From: Climate oscillations, glacial refugia, and dispersal ability: factors influencing the genetic structure of the least salmonfly, Pteronarcella badia (Plecoptera), in Western North America

Genes Primer name Sequence (5′-3′) Length Direction Frag. size
COI Ptero.COIAF ACTTGGCCAACCTGGTTCTCTT 22 Forward 844
  Ptero.COIBR GTGGAGGGTTGCTAGTCAGCTA 22 Reverse  
ATP6, COIII Ptero.ATP6BF CACAGGACACGCTGGTAGAACT 22 Forward 1216
  Ptero.COIIIR AGTGTCAATATCAGGCTGCTGCT 23 Reverse  
ND6, CYTb Ptero.ND6BF CCCAAATAAGTCACCCCTTAGCCA 24 Forward 1288
  Ptero.CYTBR CATTCTGGTTGAATGTGGACGGG 23 Reverse  
28S Ptero.28SBF ACACGTTGGGACCCGAAAGA 20 Forward 880
  Ptero.28SBR TTCCAGGGAACTCGAACGCTT 21 Reverse