Skip to main content

Table 1 Primers (5′ → 3′) used to amplify and sequence major histocompatibility class II genes in H. abdominalis

From: High intralocus variability and interlocus recombination promote immunological diversity in a minimal major histocompatibility system

# Name Sequence 5′-3′ Location
1 MHIIα-E1F3 TTACTCCGTTGCGGCGACGCC Exon 1
2 MHIIα-I1R CGTCTGTACAATACTTCCGTAC Intron 1
3 MHIIα-I1F CAGTTACCAGGACAATGAC Intron 1
4 MHIIα-I1F2 CAAAAAGCGGTGCTTATCGAG Intron 1
5 MHIIα-I1R2 GCTTTAACTTGAGATACAAGTACC Intron 1
6 MHIIα-I1R3 CACCAACAGTGAAAAACCACAAG Intron 1
7 MHIIα-I1F3 CTTGCGGGGGAAACGGCGAAG Intron 1
8 MHIIα-E2F* GACGTCATCCACACAGACATGC Exon 2
9 MHIIα-E2R2 GATTCTAGTGGCTGATCCTTCAATGC Exon 2
10 MHIIα-E3R* TGATGGGATGGGAGGGAGGATC Exon 3
11 MHIIα-E3F AGACCTTCCAACTGGACTTCAC Exon 3
12 MHIIα-E3R2 GTGAAGTCCAGTTGGAAGGTCTGG Exon 3
13 MHIIα-I3R CACGTTATTTATCATCGGCATAG Intron 3
14 MHIIα-E4F CATCAAAGGAAACCAATGCAACTG Exon 4
15 MHIIα-3UTRR GTGAGGACATAATGTGCGCCACC 3′ UTR
16 MHIIα-3UTRF GGTGGCGCACATTATGTCCTCAC 3′ UTR
17 MHIIβ-5UTRR5 GCAATACACTGGGGTTCTCTG 5′ UTR
18 MHIIβ-5UTRF2 CAGTGTATTGCAGAACATGG 5′ UTR
19 MHIIβ-5UTRR6 TATCGGTACTGGCCCATCC 5′ UTR
20 MHIIβ-5UTRF GCGACCAAAATCCGTTCCAG 5′ UTR
21 MHIIβ-5UTRR4 GGCGTGTTTGTTGTGATTTACAC 5′ UTR
22 MHIIβ-5UTRF3 GCTTTGTGCAACTAATTGTGC 5′ UTR
23 MHIIβ-5UTRR2 GGATCCAGTCTAATCTGAATCCCG 5′ UTR
24 MHIIβ-5UTRR CCAACCTGAGCACAAACTTG 5′ UTR
25 MHIIβ-UTR5F CAAGTTTGTGCTCAGGTTGG 5′ UTR
26 MHIIβ-E1R AAGGTGAGGAAAAGGAGGC Exon 1
27 MHIIβ-E1F2* GCCTCCTTTTCCTCACCTTC Exon 1
28 MHIIβ-E2R2 GATGTCATTCTGGTCACTCGAGTT Exon 2
29 MHIIβ-E2R* GAGCGCACTTTCGTAGTCAA Exon 2
  1. *RT-PCR primers.