Skip to main content

Table 2 Primers and annealing temperatures for PCR amplification

From: Ancient DNA provides new insight into the maternal lineages and domestication of Chinese donkeys

MtDNA Primers Sequence(5’-3’) Annealing temperature Length
D-loop 1F/1R L15424 CACCATCAACACCCAAAGCT 50.8°C 201 bp
H15625 ACATGCTTATTATTCATGGGGC
6F/6R L15599 GCCCCATGAATAATAAGCA 51.5°C 257 bp
H15855 TGAAGAAAGAACCAGATGCC
4F/5R L15828 TGAAACTATACCTGGCATCTGG 51.5°C 280 bp
H16107 CATGGACTGAATAACACCTTATGG
Cytb 7F/7R L14936 GAGACCCAGACAACTACACC 50.5°C 235 bp
H15170 ACTAAGAGTCAGAACACGCA
8F/8R L15133 TTCCGACCCCTTAGTCAATG 52.6°C 251 bp
H15383 AATGTTTCCCCCTTTTCTGG
  1. The positions for the complete mitochondrial genome are at GenBank X97337.