Skip to main content

Table 4 Primers to amplify the mitochondrial DNA of F. paralugubris

From: Genetic clusters and sex-biased gene flow in a unicolonial Formica ant

Locus Forward primer Reverse primer Fragment size (bp)
COI-RLR TTGATTTTTTGGTCATCCAGAAGT TAGGTGAATTTGAATTTTGTAATG ~980
COI-II a CGACGTTACTCCGAATACCC TGGCCTTGAAGAAGAAATCG ~500
COI-II b CAAAATTCAAATTCNCCNTATGA CCNGGNGTTGAGTCTATTTT ~500
ND4–ND6 a CAAATATGAAATAAATAAATTGG GTTTGTGAAGGGGTTTTAGG ~760
ND4–ND6 b AATTAAYAAAGTTAATCCTAAAACCCC CGTATAGAGATAGATTTTATRGAACAG ~950
Cytb-Fe CAGTTTAATTTCTAATGAACAAAC GGATCTCTAAAAATATATGGG ~1030
ND6-ND1 a ACATACCACAGGTTCATCAAATCC CGAGGTTTATTACCTCGAATGCGTTATG ~810
ND6-ND1 b AGTAACCCCAATCCATATTCAACC AATAGGGTCTATGCGGTCAG ~1040
ND6-ND1 c CATAACGCATTCGAGGTAATAAACCTCG GTAGCATTTTTAACTTTATTAGAACG ~770
CbM3 TATTTTCCATTATTAAAATCTGTTC AGTAAGAAATATTTACAGGTGAGGG 163/166
PB300 T/C AAACTGACCGCATAGACCCTAT-T/C GTGTTATGTTGATAAGGTGGG 171
PB30 A/G CCCACCTTATCAACATAACAC AATGCGGAAAGGTCCTAATAAGG-T/C 164
  1. The first nine pairs of primers listed above were used for the initial screen of three mitochondrial regions (COI-COII, ND4-ND6 and ND6-ND1). The last three pairs of primers (CbM3, PB300 T/C and PB30 A/G) were used for the routine typing of three polymorphic sites in the ND6-ND1 region.