Skip to main content

Table 1 Sequences of primers used for PCR amplification and sequencing.

From: Evidence for a rapid rate of molecular evolution at the hypervariable and immunogenic Mycobacterium tuberculosis PPE38 gene region

Primer name Sequence (5' -- 3') Comment
PPE38F TTTTCGGTGTGGATTGTCT 3398 bp amplicon for H37Ra-like genotype, 1331 bp amplicon for RvD7 genotype.
PPE38R GCCAGGGATTTCCAACGAC  
PPE38IntF ATGTCGGCGGAGTTGGGTAAG 1351 bp amplicon for H37Ra-like genotype, no product for RvD7 genotype.
PPE38IntR TAGCCTGACCAGCCGACAACT  
21delF GGGGATGATGCCGATGC 111 bp amplicon for wild-type genotype, 90 bp amplicon for 21del genotype.
21delR ACACTGGGCCGAGCCTG  
IS5' GGTACCTCCTCGATGAACCAC IS6110-binding sequencing primer used to determine region upstream of IS6110.
Xho1 TTCAACCATCGCCGCCTCTAC IS6110-binding sequencing primer used to determine region downstream of IS6110.
plcA5' CAAATGTCCGGGACAAGG Primes from the 5' region of plcA. Used to PCR and sequence the region between plcA and PPE38 in conjunction with the PPE38IntF primer in M. canettii isolates.