Skip to main content

Table 1 Sea lamprey olfactory organ CR gene expression from 454, EST and RT-PCR data.

From: The sea lamprey Petromyzon marinusgenome reveals the early origin of several chemosensory receptor families in the vertebrate lineage

  olfactory organ 454 transcripts RT-PCR Results       
Gene (Adult, Parasite) olfactory brain liver gill kidney gonad RT-primer 5'-3' Tm
1681.OR230* 3,4 x      x tcaataatggagtcgcttgc 60
         tctcacgttgaaatgccaag  
2061.V1R320 0,2 x x     x gcagtgtcgtggtctctcaa 56
         gaatgtagcgcgagttctcc  
18775.V1R342 3,1 x x x x x x tctgataagcctcgcgttct 54
         ctcgggcacatttggtattt  
6425.OR330 a 1,5 x      x ccgtactgcgactacctcgt 58
         ggcactcgtagaggatgagc  
2407.OR326 2,0 x x x    x gctcgaaggatttcaacagg 57
         aggtcacggtcctcacaaag  
3267.OR325 7,1 x x     x gtagtggctttgggcatcat 57
         cacgaatattgccacgaaaa  
3721.TAAR351 2,0 x      x gtgtggaccttccaccaagt 60
         gcagctgcctgaagtagagg  
9755.TAAR355 a 2,0 x      x gtagccatcgccttcttcag 60
         gaggcgtagaaccagcactc  
16230.TAAR353 0,1 x       ctgcgtcgactccttctacc 52
         ggaggagttcgtcagcatgt  
3717.V1R311 not detected x      x tgaagaatggggaactgctc 54
         atacaagagcaaccggcatc  
1548.PRH340 not detected   x x    x aacgtgaccaacctgctcat 54
         gctgcatgagaaacacgaag  
11722.V1R311 not detected x       atcaagacgctgctcatcct 54
         cccagcagatcacgaatatg  
5673.OR343 not detected   x      atcctcctgtgcaacctgtc 60
         ggccggcagatgtagaagta  
2594.TAAR358 not detected x       tatctcttggctgccgttct 50
         gccggagacaaaaacacatt  
107483.OR345 not detected x       tccacatccagatggtgttc 60
         ttggtgttctccaccaggtc  
17613.OR230 not detected,        atcatggtcacctcctacgc 60
  pseudogene        ggcaaccagaagatcaggaa  
9755.TAAR355 b 2,0        no RT primers  
14718.TAAR353 1,0        no RT primers  
2008.CASR839 1,1        no RT primers  
10424.MGR935 1,1        no RT primers  
3267.OR361 0,1        no RT primers  
1268.OR328** 0,0   NCBI ESTs from embryo   EG337313  
         EG335699  
10796.OR320 2,2        no RT primers  
12707.TAAR348 2,0        no RT primers  
7812.OR322 1,0        no RT primers  
14563.OR381 0,1        no RT primers  
15806.TAP† 1,0        no RT primers  
  1. Expression data is shown for a subset of lamprey CR genes, including all OR, TAAR and V1R genes detected by olfactory organ cDNA 454 sequencing. RT-PCR results, primer sequences, annealing temperatures and NCBI EST data are also included. Gonad includes both adult testis and undifferentiated gonad from parasites. The partial gene 1681.OR230 corresponds to three ESTs (EE739806, EE738866 and EB081557) from adult olfactory organ*. Two sequences from the NCBI EST database (EG337313 and EG335699) obtained from sea lamprey embryo map to the gene 1268.OR328**. Expression of a calcium-sensing receptor (2008.CASR839) and a metabotropic glutamate receptor (10424.MGR935) were detected in the olfactory organs of adult sea lamprey. A 540 bp EST represents a cellular nucleic acid binding protein† expressed in both adult olfactory organ and embryo that was not included in the phylogenetic analysis.