Skip to main content

Table 4 Primers used for single gene RT-PCR

From: Independent inactivation of arginine decarboxylase genes by nonsense and missense mutations led to pseudogene formation in Chlamydia trachomatisserovar L2 and D strains

Reaction Genes Primer names Forward primer sequence Reverse primer sequence Size (bp)
  hsp60 (groEL_1) hsp3/hsp4 GACCGCCAGTTAAGATAGCG TCTCTAGCTACTTCGCAACAAATCC 297
1 CTL0626 CTL06265'F/
CTL06265'R
GCACACCATCACTATCAC GCGCTTGCTTGAGATTTC 226
2 CTL0627 CTL06275'F/
CTL06275'R
GTTGGCGAGTCCGATGATG GACTTCTAATACAGCACCATGTTTG 195
3 CTL0628 CTL06285'F/
CTL06285'R
GAAACGGTCTCCTACTAGC GGTGGGAAGAAATAGTTAAGG 357