Skip to main content

Table 3 Primers used for operon RT-PCR

From: Independent inactivation of arginine decarboxylase genes by nonsense and missense mutations led to pseudogene formation in Chlamydia trachomatisserovar L2 and D strains

Reaction Genes Primer names Forward primer sequence Reverse primer sequence Size (bp)
A CTL0625 to 626 CTL06253'F/
CTL06265'R
GCTCATTAGCAACGAAGCC GCGCTTGCTTGAGATTTC 430
B CTL0626 to 627 CTL06263'F/
CTL06275'R
GCTCCAGACTTCCAACTC GACTTCTAATACAGCACCATGTTTG 404
C CTL0627 to 628 CTL06273'F/
CTL06285'R
GCATAGTGAGTTCCAATATTTC GGTGGGAAGAAATAGTTAAGG 501
D CTL0628 to 629 CTL06283'F/
CTL06295'R
CGATCATGGCTCTTG TGTAAAGCCATGAAGAAGG 395