Skip to main content

Table 1 Sequences and references of primers used in this study.

From: Unveiling an ancient biological invasion: molecular analysis of an old European alien, the crested porcupine (Hystrix cristata)

Gene Primer Sequence (5'-3') Ta °C Ref.
CR Hy-For1 CACCATCAGCACCCAAAG 56 [34]
  Hy-For2 AAACCAGCAACCCGACAG 56 [34]
  Hy-For3 AATTGTAGCTGGACTTATAAATC 56 [34]
  Hy-For4 CCCCCGTAAATTTAATAGCTT 56 [34]
  Hy-Rev1 AAGCATTTTCAGTGCTTTRC 56 [34]
  Hy-Rev2 GGGGGTTTGTCAATAGATTG 56 [34]
  Hy-Rev3 GTCCTTCAAGCATTAAAAGAAATC 56 [34]
  Hy-Rev4 AGAAGAGGGATCCCTGTC 56 [34]
  Hy-For5 AATGCAAGACCCCATAAGAC 56 [34]
  Hy-Rev5 GAGTGGGCGATTTTAAGTGT 56 [34]
12S 12S-L82 CATAGACACAGAGGTTTGGTCC 54 [35]
  12S-H293 GCACGAGATTTACCAAC 54 [35]
  12S-H618 TATCGATTATAGAACAGGCTCC 54 [35]
Cyt b Cyt01F GAACTAATGACAAACATCCGAAAA 54 This study
  Cyt05F AACACGATTCTTTGCTTTCCA 54 This study
  Cyt06R TGGACTAGTACAAGGGCTGTGA 54 This study
  Cyt02R TTCTGGTTTAATATGGGGAGGA 54 This study
  1. CR: Control Region; 12S: rRNA 12S; Cyt b: Cytochrome b; Ta: PCR annealing temperature.