Skip to main content

Table 4 Primers used for RT-PCR

From: Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomycete Trichoderma/Hypocrea

Target Primer name 5' -> 3' sequence T2 [°C] Size [bp]
ha_1 b hfb4RTfw CTGCTTCTGAGGTCGTCGAG 59.0 244
  hfb4RTrv GGAAGAGCATCCTGGCAC   
ha-1c hfb5RTfw CTCTTTACATTGGGCCTCG 55.5 208
  hfb5RTrv CAAGAGTGCAGCAATTGAGC   
tef1 tef1RTFw GTACTGGTGAGTTCGAGGCTG 59 350
  tef1RTRv GGGCTCGATGGAGTCGATG   
\