Skip to main content

Table 2 Variable DNA sites matrix (cytochrome b)

From: Climate-driven diversification in two widespread Galerida larks

                   1111111111111112222222222222222222  
     112233457888990012445556788990000111122234566777  
Haplotype GenBank 17032517350589143927382343217061268136806901925479 n
The_MO_2 AY769740 TCCTCCTACTACACTACGATCCGCCTATAGATCCCGTTACCACACATCCT 31
The_MO_6 AY769742 ..T............................................... 1
The_MO_12 AY769743 .................A................................ 1
The_MO_19 AY769741 ...............................C.................. 4
The_TU_1 EF445418 .........................C.................C.G.... 1
The_TU_3 EF445419 .........................C.................C...... 4
Pra_ET_1 EF445421 .....TC....A..C....C..A......A....TA...T..TC.G..T. 2
Eli_SO_2 EF445423 ...CTTC....A..C.TAC..TA...G..A.....A......TC.G...C 2
Cri_MO_6 AY769746 CT.C..CG.CC.GTC..AC...ATGC.C..G....A.C...G.CTGCT.. 51
Cri_MO_11 AY769748 CT.C..CG.CC.GTC..AC...ATGC.C..G....AAC...G.CTGCT.. 1
Cri_IR_2 DQ028951 CT.C..CG.CC.GTC..AC...ATGC.C..G..T.A.CG..G.CTGCT.. 1
Cri_RU_1 EF445426 CT.C..CG.CC.GTC..AC...ATGC.C..G..T.A.C...G.CTGCT.. 2
Cri_RU_8 EF445427 CT.C..CGTCC.GTC..AC...ATGC.C..G....A.C...G.CTGCT.. 3
Cri_AL_1 DQ028953 CT.C..CG.CC...C..AC...ATGC.C..G....A.C...G.TT.CT.. 12
Cri_CH_1 DQ028954 CT.C..CG.CC.C.C..AC...ATGC.C..G....A.C...G.TT.CT.. 1
Cri_MA_2 DQ028956 CT.C..CG.CC...C..AC...ATGC.C..G....A.C.....TT.CT.. 1
Cri_TU_1 DQ028955 CT.C..CG.CC...C..AC...ATGC.C..G....A.C..AG.TT.CT.. 3
Cri_KE_2 EF445429 CT.C..CG.CC...C..AC...ATGC.C..G..T.A.C...G.TTGCT.. 1
Ran_MO_2 AY769749 .T.C..CG.CC..TCG.AC...ATG..C.......A.C.....TTGCT.C 19
Mal_IN_1 EF445430 CT.C.TCG.CC...C..AC.T.ATG..CGAG.A....C.....TTGCT.C 2
  1. 20 haplotypes for the short (291 bp) cytochrome b fragment (see Tables 4–5 for the geographic origin of samples).