Figure 5

Additivity and epistasis in RNA folding The frequency of mutant classes is plotted against the number of base substitutions (d). (a) Log. plot. The patterns in the bars indicate the mutant classes: (from bottom) mesh, additive neutral; dots, positive epistasis; black, negative epistasis; stripes, additive deleterious (see Table 1 for the definition). The data were generated by RNA folding (by using [7]) with a S. cerevisiae tRNAphe sequence as a reference sequence: GCGGAUUUACCUCAGUUGGGAGAGGGCCAGACUGAACAUCUGGAGGUCCGGCGCGCGAUACGCCGAAUUCGCACCA (each non-RNA is converted to RNA). We examined all possible mutants at d = 1, 2 and the subsets of mutants for other d values (2<d<10, the portion of examined mutants is respectively, 10, 1, 0.1, 0.01, 0.3 × 10^-3, 0.1 × 10^-3, 0.4 × 10^-5%). These observations in RNA folding are compared with the following two analytical predictions. The solid line is the probability of neutral replication estimated under the additive assumption (λ^d, λ = 0.307). The dashed line is the probability of neutral replication estimated with epistasis ((d), see Methods section – Probabilistic approach). (b) Linear plot. Symbols: ● the frequency of the neutral mutants (additive neutral and positive epistasis); ○ the frequency of the deleterious mutants (additive deleterious and negative epistasis).