Skip to main content

Table 2 Primers used for SYBR green qPCR

From: The sea lamprey has a primordial accessory olfactory system

GENE FWD (SENSE) REV (SENSE) REV (5’-3’)
OR3267 aaccgggctgagcaagaac cgagggagcgagaaacttca tgaagtttctcgctccctcg
OR6425 gaagaacatctgtgccatgca gcagaacgtcgcgtcctt aaggacgcgacgttctgc
TAAR3721 tctgcagctgcctgaagtagag ccatcgcgggcaaca tgttgcccgcgatgg
V1R18775 attggcacgtgtcacatgaga gagagaacgcgaggcttatcag ctgataagcctcgcgttctctc
CASR ttttgaccaagatgcaagacaag cccgccagcccttttt aaaaagggctggcggg
AC9 cgccataggtatccacatcttca tggcccaccttgaggaaag ctttcctcaaggtgggcca
GP ccaggccagggaaatgc tgagctgaggcaagaagtaatcag ctgattacttcttgcctcagctca