Skip to main content

Table 3 Primer sequences and amplification conditions for GOT1 paralogs from T. californicus

From: Gene conversion yields novel gene combinations in paralogs of GOT1 in the copepod Tigriopus californicus

Gene Region Forward Primer (5′ to 3′) Reverse Primer (5′ to 3′) Size (bp) Ann. Temp.
GOT1p1 AGAAGTTGGTCATTCATTCTTCATC CTTATTGACGGCCTCATTGATGGA 1243 58°C
GOT1p2 ATATCCGTGCCCAAAAGCCTAC CTTATTGACGGCCTCATTGATGGA 1249 58°C
GOT1Sr (5′end) AGTATCCCAACATGTCTGCCTTCG GCAATATAGATAATGAATAACGACACT ~17001 63˚C2
GOT1Sr (middle) GAGTGTCGTTATTCATTATCTATATTGC TCCTCAACCAGGTTTTAGAGTCA 1751 SD, 1722 AB, 2855 SCN 63°C
GOT1Sr (3′end) CAATTGACTCTAAAACCTGGTTGAG GGTTATTCTTGAATTTGTTGTGCTTCGT ~1400bp 63°C
GOT1Sd CAGGAACAATGGAAGATCATAGCCA GGTTATTCTTGAATTTGTTGTGCTTCGT ~1700bp  
GOT1_6A ATGGCCACAACCAAGTTTATTG TGGTCTTTGATGGGGCCTTCGTTCG ~1600bp 55°C
  1. 1 There are small size variations due to indels in these fragments.
  2. 2 For the amplifications of the GOT1Sr gene fragments the Phusion kit (NEB) was used to amplify products.