Skip to main content

Table 6 PCR Primers

From: The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatiliscryptic species complex

Gene Primer name Sequence (5′-3′)
mmr-a4 MRPs3 ATGAAATCAATTTTATGTTCCTSCTG
  MRPurt3 TTAATCARAATAAAGAGGAAAAG
mmr-a7 MRPs3.1 ATGAAATCAATTTTATGTATCCTSCTG
  MRPutr1 GTATTTTTTATTTTTGATAAAAATCTG
mmr-b 2MRPs2 GTACCAGTYAAGCAAATAGCTGAACC
  2MRPutr1 ATATTTTAAATTAACCTGAACC
hsp-82 Hsp3:b GARACNTTYGCNTTYCARGCN
  hsp8:b RTGRTCYCCCARTCRTTNGT
coxI HCO2198 TAAACTTCAGGGTGACCAAAAATCA
  LCO1490 GGTCAACAAATCATAAAGATATTGG