Skip to main content

Table 1 PCR primers for amplification of the COI gene.

From: A hitchhikers guide to the Galápagos: co-phylogeography of Galápagos mockingbirds and their parasites

Species Primer name Direction Primer sequence Reference
Mimus BirdF1_Nes F AACCAACCACAAAGATATCGGCAC Modified from BirdF1 [87]
  COIH_Nes R GGGCTACTACGTAGTAAGTGTCATGT Modified from COI H7005 [74]
  Nes_InF F CTCACCGACCGCAACCTCAA This study
  Nes_InR R GGATAGTATGGCTCATACTATTCCTATGTA This study
Analges An_F F ATATCCACTAATCACAAAGATATTG This study
  COI H7005 R CCGGATCCACNACRTARTANGTRTCRTG [74]
  An_InF F CCGTAATTTTAATTCTACTTTTTTTG This study
  An_InR R CAAACCCAGGTAAAATCAAAATATA This study
Myrsidea Myr_F F ATATTGGYACTCTYTAYTTAATCTTTGGTT This study
  COI H7005 R CCGGATCCACNACRTARTANGTRTCRTG [74]
  Myr_InF F CCGAAATTTTAATACCTCTTTCTTTG This study
  Myr_InR R AGATTATACCAATGACCCCAAAACT This study
Brueelia COI LCO1490 F GGTCAACAAATCATAAAGATATTGG [88]
  COI H7005 R CCGGATCCACNACRTARTANGTRTCRTG [74]
  Bru_InF F TCGTAATTTGAATTCTTCTTTTTTTG This study
  Bru_InR R ACCCAAAAACTTCCTTCTTTCC This study