Skip to main content

Table 2 Sets of primers used in PCR amplifications.

From: Bridging gaps in the molecular phylogeny of the Lymnaeidae (Gastropoda: Pulmonata), vectors of Fascioliasis

Locus Forward Primer Sequence 5' > 3' Reverse Primer Sequence 5' > 3'
ITS-1 Lym1657 CTGCCCTTTGTACACACCG ITS1-Rixo TGGCTGCGTTCTTCATCG
ITS-2 News2 TGTGTCGATGAAGAACGCAG ITS2-Rixo TTCTATGCTTAAATTCAGGGG
16S 16F CGCCTGTTTATCAAAAACAT 16R CCGGTCTGAACTCAGATCACGT