Skip to main content

Table 2 Primer pairs (same prefix ending in fw or rv) used to amplify the Xenopus and chicken PTH family members.

From: Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

  Xenopus laevis Chicken
PTH PTHfw: aggagacgggctgtgagtgag$ PTHfw: atgacttctacaaaaaatctg$
  PTHrv: tcattggatgccaggcttta$ PTHrv: tggcttagttttaaagagta$
  PTH2fw: tcagatgaagttacaggac* PTHfw: gcataaccttggagagcatcg*
  PTH2rv: cttagtgctatgcctatg* PTHrv: cctctgggtcctggcatc*
PTHrP PTHrPfw: cagtatctccacgacaaagg*$ PTHrP(1-139)fw: ctgagagcccagtcttgga$
  PTHrP(1-131)rv: ttacctgtaatctaattcttcca$ PTHrP(1-139)rv: gggtaacaatttcagtaact$
  PTHrP(1-144)rv: cgggtgccgctcatctgc$ PTHrP(1-141)5utrAfw: gaagggagtagcacctgggc$
  PTHrPrv: tggtggcagggagtaag* PTHrP(1-141)5utrBfw: ggcacctgcttttaaaaccc$
   PTHrP(1-141)5utrCfw: gctaacagaggaactgcgac$
   PTHrP(1-141)5utrDfw: aggactgacccctcctttcc$
   PTHrP(1-141)rv: gatcccctctactgatcttcc$
   PTHrP(1-139)fw: agcaaagcctggaaaacg*
   PTHrP(1-139rv: gtggaaaagatacagcagaattacc*
   PTHrP(1-141)5utrAfw: caggcttgcggtgaggcta*
   PTHrP(1-141)5utrArv: gcgaaactccactgctgaaag*
   PTHrP(1-141)5utrBfw: tgacccctcctttccttgc*
   PTHrP(1-141)5utrBrv: ggcacagaataactcagaagaaac*
   PTHrP(1-141)5utrCfw: cagaggaactgcgacgaacaac*
   PTHrP(1-141)5utrCrv: gcgaaactccactgctgaaag*
   PTHrP(1-141)5utrDfw: ggcacctgcttttaaaaccc*
   PTHrP(1-141)5utrDrv: aaggttttgatgaaagataggaatcc*
PTH-L PTH-Lfw: gagagatcagttgcagagg$ PTH-Lfw: gaacgacaagagaaggaaag$
  PTH-Lrv: tgaaggatcccgctccatt$ PTH-Lrv: ctgcttcatcgggtttga$
  PTHLfw: ttgaagaaataaatcgccagag* PTHLfw: gataaggcgagggcatttcaag*
  PTHLrv: atgctgctgattctttgctgt* PTHLrv: cctgctgctggctgtgtg*
r18S 18s fw tgacggaagggcaccaccag* 18s rv aatcgctccaccaactaagaacgg*
  1. Note: $ indicates primers for RT-PCR and * indicates primers for q-PCR. For Xenopus PTHrP the same forward primer was used for each pair.