Skip to main content

Table 2 Sequence Genbank accession numbers and primers used to assay gene copy number in T. thermophila and T. pyriformis

From: Mutation accumulation in Tetrahymena

  Primers GenBank Acession number
Actin F: TCCCATTGAACACGGTATTGTC T.thermophila: AY315823
  R: TGTAGAAGCAATGATGCCAGATCT T.pyriformis: X05195
alpha- F: ACGCCAAGAGAGCCTTCGT T.thermophila: M86723
Tubulin R: CGGAGAATTCACCTTCTTCCAT T.pyriformis: X12767
Ef1a1 F: CGGTTTCAACATTAAGGGTGTCT T.thermophila: CH670356
  R: GGCATCGGAAGCGACATT T.pyriformis: D11083