Skip to main content

Table 2 Sources and sequences of forward (F) and reverse (R) primers.

From: Molecular phylogeny of pearl oysters and their relatives (Mollusca, Bivalvia, Pterioidea)

Locus Primer Sequence, 5' - 3' Source
18S 1F (F) TACCTGGTTGATCCTGCCAGTAG [162]
  3F (F) GTTCGATTCCGGAGAGGGA [162]
  5R (R) CTTGGCAAATGCTTTCGC [162]
  9R (R) GATCCTTCCGCAGGTTCACCTAC [162]
  A20 (F) ATGGTTGCAAAGCTGAAAC [162]
  S2 (F) GAGTAAATTAGAGTGTTCAAAGCA [162]
  S3 (R) CGGAATTAACCAGACAAATC [162]
28S D1F (F) GGGACTACCCCCTGAATTTAAGCA [163]
  D6R (R) CCAGCTATCCTGAGGGAAACTTCG [163]
16S 16SaR (F) CGCCTGTTTATCAAAAACAT [164]
  16SbR (R) CCGGTCTGAACTCAGATCACGT [164]
  16SmasF (F) CGCCTGGTTGATTAAAAACATTGCTGC [161]
  16SmasR (R) CCGGTTTGAACTCAGATCACGTA [161]
H3 H3aF (F) ATGGCTCGTACCAAGCAGACVGC [165]
  H3aR (F) ATATCCTTRGGCATRATRGTGAC [165]