Skip to main content

Table 1 PCR primers for amplification of cod α1-β1 gene pair and for screening BAC library.

From: Genomic organization and gene expression of the multiple globins in Atlantic cod: conservation of globin-flanking genes in chordates infers the origin of the vertebrate globin clusters

Gene Name Sequence (5' to 3')
α1-β1 A1-B1F GCAAATTGTTCAAGTTATTCCCCCTAAC
  A1-B1R TAAAGACTGACCTGCAACGCGAGTGGT
α1 A1-bacF CAGACCAAGACTTACTTCAGCC
  A1-bacR GCTCGCTCAGAGTGAGAAGAC
α2 A2-bacF CCGATGATATCGGAGCTGAGG
  A2-bacR CTAAGGCTGAGGAGTCCTCC
β1 B1-bacF ATGGTTGAATGGACAGCTGC
  B1-bacR GTCGACGTGCAGTTTCTC
β2 B2-bacF TGGACAGATAGTGAGCGCG
  B2-bacR AGTGGAGCAGAGACAGCTC