Skip to main content

Table 2 qRT-PCR primers sequences with their target genes (when known)

From: Suppression subtractive hybridization analysis reveals expression of conserved and novel genes in male accessory glands of the ant Leptothorax gredleri

Target genes for qRT-PCR   
leukocyte-antigen-related-like LgCon1F
LgCon1R
5' TTCGTGCGCGTTCTGCTTACC 3'
5' GCATCATCGCAGAATACCGGTC 3'
CG1486 LgCon12F
LgCon12R
5' GAAGCGGAAGATGTGGC 3'
5' GCCAGCTCTAACCGAAAC 3'
ciao-1 S3BO6-F
S3BO6-R
5' CCTAATGATATCGTCACCGC 3'
5' GGAATATAAACCTGGGAACG 3'
CG32432 S8H10-F
S8H10-R
5' GATCGATTCGAGCAGAGACA 3'
5' TGTTTATCGGGAATCGTTTC 3'
US3 - no match LgCon9F
LgCon9R
5'CTCATCCCTGGGACTTGCAC 3'
5'GTGGACCCCGAGAAATAGA 3'
US7 - no match S6FO5-F
S6FO5-R
5' GTTACGCTTTACGCAACGAG 3'
5' CTTTCATTCCACGGCTCATC 3'
elf-1 alpha LG-ELF1aF
LG-ELF1aR
5' CATGATCACCGGTACCTCG 3'
5' CCAGCATGTTGTCTCCGTG 3'