Skip to main content

Table 3 List of primers

From: Molecular diversity of antimicrobial effectors in the oyster Crassostrea gigas

  Sense primers (5'3') Antisense primers (5'3')
gene   PCR amplification from cDNA and gDNA
Cg-prp Cg-prp2F CACCATGTTCTCTCGGAGGA Cg-prp3R TCTCTTCATCAAAACAAAGTCG
Cg-defm Cg-defm5F CCACTTTCTGGTTTGCTGAG Cg-defU4R TCTTGGTCAGATTCAGWCTGG
Cg-defh Cg-defh4F CTACCAGTTGTTCATACAGAG Cg-defU4R TCTTGGTCAGATTCAGWCTGG
Cg-bpi Cg-bpi1F CTACCAGTTGTTCATACAGAG Cg-bpi1R GGATTTAATATATCCGTCTTCTG
Cg-actin Cg-actin1F CTTCACAATGGGAGATGAAGA Cg-actin1R GTAAACTCCTATCACAGCCAC
   gene copy number estimation
Cg-prp Cg-prpUq1F CCACCATGTTCTCTCGGAGG Cg-prpUq1R CTTGTAGAACGGGCTAGCAC
Cg-defs Cg-defUq1F CTGCAGACATGGCTTTTGCTG Cg-defUq1R GTACATCTTGACCAGAGCGTG
Cg-bpi Cg-bpiq2F AGATAGAAATAGGAATGGACGG Cg-bpiq2R GTTATAGATCCACGCTGCTCC
Cg-actin Cg-actq2F CAGCTATGTAGGAGACGAG Cg-actq3R CACGGAGTTCATTGTAGAAGG
   5' and ' RACE
Cg-defh Cg-defh3'sp1 GCTGGATTTGGGTGTCCG race (dT) anchor GACCACGCGTATCGATGTCGAC
Cg-defh    Cg-defh5' sp1 CACAGTAGCCCGCTCTACA
Cg-defh oligo (dT) anchor GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTV Cg-defh5' sp2 CGGACACCCAAATCCAGC
Cg-defh race (dT) anchor GACCACGCGTATCGATGTCGAC Cg-defh5' sp3 CCATYTCTGCAGAAACCATC
Cg-defm    Cg-defm5' sp1 CATCTTAACCAGAGCGTGGC
Cg-defm oligo (dT) anchor GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTV Cg-defm5' sp2 GGACTTGCAGTGATTGTTGC
Cg-defm race (dT) anchor GACCACGCGTATCGATGTCGAC Cg-defm5' sp3 CATCAGAAGGACAGCTAGTG